MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-HA tag

Cat: DG70241-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MUT/Methylmalonyl CoA mutase Reagents
CRO Services
Product recommended

All MUT/Methylmalonyl CoA mutase Reagents
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-HA tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Canine methylmalonyl CoA mutase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MUT/Methylmalonyl CoA mutase Background Information
Full Name
methylmalonyl CoA mutase

MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
MUT/Methylmalonyl CoA mutase cDNA ORF Clone in Cloning Vector, Canine DG70241-U
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, untagged DG70241-UT
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-GFPSpark® tag DG70241-ACG
MUT/Methylmalonyl CoA mutase Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70241-ACGLN
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, N-GFPSpark® tag DG70241-ANG
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-OFPSpark® tag DG70241-ACR
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, N-OFPSpark® tag DG70241-ANR
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70241-CF
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70241-NF
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-His tag DG70241-CH
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, N-His tag DG70241-NH
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, N-HA tag DG70241-NY
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, C-Myc tag DG70241-CM
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Canine, N-Myc tag DG70241-NM

MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MUT/Methylmalonyl CoA mutase cDNA ORF Clone in Cloning Vector, Mouse MG59776-U
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, untagged MG59776-UT
MUT/Methylmalonyl CoA mutase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59776-ACGLN
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59776-ACG
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59776-ANG
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59776-ACR
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59776-ANR
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59776-CF
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59776-NF
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, C-His tag MG59776-CH
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, N-His tag MG59776-NH
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, C-HA tag MG59776-CY
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, N-HA tag MG59776-NY
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, C-Myc tag MG59776-CM
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Mouse, N-Myc tag MG59776-NM

MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MUT/Methylmalonyl CoA mutase cDNA ORF Clone in Cloning Vector, Human HG16638-U
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, untagged HG16638-UT
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, C-GFPSpark® tag HG16638-ACG
MUT/Methylmalonyl CoA mutase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16638-ACGLN
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, C-OFPSpark® tag HG16638-ACR
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16638-CF
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16638-NF
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, C-His tag HG16638-CH
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, N-His tag HG16638-NH
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, C-HA tag HG16638-CY
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, N-HA tag HG16638-NY
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, C-Myc tag HG16638-CM
MUT/Methylmalonyl CoA mutase cDNA ORF Clone, Human, N-Myc tag HG16638-NM
info info
添加购物车成功! 添加购物车失败!