IL-4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70021-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-4 Reagents
CRO Services
Product recommended

All IL-4 Reagents
IL-4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Canine interleukin 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-4 Background Information

Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 4
References
  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.
  • IL-4 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-4 cDNA ORF Clone in Cloning Vector, Canine DG70021-G
    IL-4 cDNA ORF Clone, Canine, untagged DG70021-UT
    IL-4 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70021-ACGLN
    IL-4 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70021-ACG
    IL-4 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70021-ACR
    IL-4 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70021-NF
    IL-4 cDNA ORF Clone, Canine, C-His tag DG70021-CH
    IL-4 cDNA ORF Clone, Canine, N-His tag DG70021-NH
    IL-4 cDNA ORF Clone, Canine, C-HA tag DG70021-CY
    IL-4 cDNA ORF Clone, Canine, N-HA tag DG70021-NY
    IL-4 cDNA ORF Clone, Canine, C-Myc tag DG70021-CM
    IL-4 cDNA ORF Clone, Canine, N-Myc tag DG70021-NM

    IL-4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-4 cDNA ORF Clone in Cloning Vector, Rhesus CG90281-G
    IL-4 cDNA ORF Clone, Rhesus, untagged CG90281-UT
    IL-4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90281-ACGLN
    IL-4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90281-ACG
    IL-4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90281-ACR
    IL-4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90281-CF
    IL-4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90281-NF
    IL-4 cDNA ORF Clone, Rhesus, C-His tag CG90281-CH
    IL-4 cDNA ORF Clone, Rhesus, N-His tag CG90281-NH
    IL-4 cDNA ORF Clone, Rhesus, C-HA tag CG90281-CY
    IL-4 cDNA ORF Clone, Rhesus, N-HA tag CG90281-NY
    IL-4 cDNA ORF Clone, Rhesus, C-Myc tag CG90281-CM
    IL-4 cDNA ORF Clone, Rhesus, N-Myc tag CG90281-NM

    IL-4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-4 cDNA ORF Clone in Cloning Vector, Rat RG80236-G
    IL-4 cDNA ORF Clone, Rat, untagged RG80236-UT
    IL-4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80236-ACGLN
    IL-4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80236-ACG
    IL-4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80236-ACR
    IL-4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80236-CF
    IL-4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80236-NF
    IL-4 cDNA ORF Clone, Rat, C-His tag RG80236-CH
    IL-4 cDNA ORF Clone, Rat, N-His tag RG80236-NH
    IL-4 cDNA ORF Clone, Rat, C-HA tag RG80236-CY
    IL-4 cDNA ORF Clone, Rat, N-HA tag RG80236-NY
    IL-4 cDNA ORF Clone, Rat, C-Myc tag RG80236-CM
    IL-4 cDNA ORF Clone, Rat, N-Myc tag RG80236-NM
    IL-4 qPCR Primer Pairs, Rat RP300222

    IL-4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-4 cDNA ORF Clone in Cloning Vector, Mouse MG51084-G
    IL-4 cDNA ORF Clone, Mouse, untagged MG51084-UT
    IL-4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51084-ACGLN
    IL-4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51084-ACG
    IL-4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51084-ACR
    IL-4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51084-CF
    IL-4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51084-NF
    IL-4 cDNA ORF Clone, Mouse, C-His tag MG51084-CH
    IL-4 cDNA ORF Clone, Mouse, N-His tag MG51084-NH
    IL-4 cDNA ORF Clone, Mouse, C-HA tag MG51084-CY
    IL-4 cDNA ORF Clone, Mouse, N-HA tag MG51084-NY
    IL-4 cDNA ORF Clone, Mouse, C-Myc tag MG51084-CM
    IL-4 cDNA ORF Clone, Mouse, N-Myc tag MG51084-NM
    IL-4 qPCR Primer Pairs, Mouse MP201042

    IL-4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-4 cDNA ORF Clone, Human, untagged HG11846-UT
    IL-4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11846-ACG
    IL-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11846-ACGLN
    IL-4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11846-ACR
    IL-4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11846-CF
    IL-4 cDNA ORF Clone, Human, C-HA tag HG11846-CY
    IL-4 cDNA ORF Clone, Human, C-Myc tag HG11846-CM
    IL-4 qPCR Primer Pairs, Human HP104637
    info info
    添加购物车成功! 添加购物车失败!