EMC2 cDNA ORF Clone, Canine, C-His tag

Cat: DG70209-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EMC2 Reagents
CRO Services
Product recommended

All EMC2 Reagents
EMC2 cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Canine ER membrane protein complex subunit 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EMC2 Background Information
Full Name
ER membrane protein complex subunit 2

EMC2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
EMC2 cDNA ORF Clone in Cloning Vector, Canine DG70209-U
EMC2 cDNA ORF Clone, Canine, untagged DG70209-UT
EMC2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70209-ACGLN
EMC2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70209-ACG
EMC2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70209-ANG
EMC2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70209-ACR
EMC2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70209-ANR
EMC2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70209-CF
EMC2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70209-NF
EMC2 cDNA ORF Clone, Canine, N-His tag DG70209-NH
EMC2 cDNA ORF Clone, Canine, C-HA tag DG70209-CY
EMC2 cDNA ORF Clone, Canine, N-HA tag DG70209-NY
EMC2 cDNA ORF Clone, Canine, C-Myc tag DG70209-CM
EMC2 cDNA ORF Clone, Canine, N-Myc tag DG70209-NM

EMC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EMC2 cDNA ORF Clone in Cloning Vector, Human HG23899-U
EMC2 cDNA ORF Clone, Human, untagged HG23899-UT
EMC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23899-ACGLN
EMC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG23899-ACG
EMC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG23899-ANG
EMC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG23899-ACR
EMC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG23899-ANR
EMC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23899-CF
EMC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23899-NF
EMC2 cDNA ORF Clone, Human, C-His tag HG23899-CH
EMC2 cDNA ORF Clone, Human, N-His tag HG23899-NH
EMC2 cDNA ORF Clone, Human, C-HA tag HG23899-CY
EMC2 cDNA ORF Clone, Human, N-HA tag HG23899-NY
EMC2 cDNA ORF Clone, Human, C-Myc tag HG23899-CM
EMC2 cDNA ORF Clone, Human, N-Myc tag HG23899-NM
info info
添加购物车成功! 添加购物车失败!