Angiopoietin-like 7 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70030-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Angiopoietin-like 7 Reagents
CRO Services
Product recommended

All Angiopoietin-like 7 Reagents
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1035 bp
Description
Full length Clone DNA of Canine angiopoietin-like 7 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-like 7 Background Information
Full Name
angiopoietin-like 7

Angiopoietin-like 7 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Rhesus CG90028-G
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, untagged CG90028-UT
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90028-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90028-ACG
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90028-ACR
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90028-CF
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90028-NF
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-His tag CG90028-CH
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-His tag CG90028-NH
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-HA tag CG90028-CY
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-HA tag CG90028-NY
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, C-Myc tag CG90028-CM
Angiopoietin-like 7 cDNA ORF Clone, Rhesus, N-Myc tag CG90028-NM

Angiopoietin-like 7 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Canine DG70030-G
Angiopoietin-like 7 cDNA ORF Clone, Canine, untagged DG70030-UT
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70030-ACG
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70030-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70030-ACR
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70030-NF
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-His tag DG70030-CH
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-His tag DG70030-NH
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-HA tag DG70030-CY
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-HA tag DG70030-NY
Angiopoietin-like 7 cDNA ORF Clone, Canine, C-Myc tag DG70030-CM
Angiopoietin-like 7 cDNA ORF Clone, Canine, N-Myc tag DG70030-NM

Angiopoietin-like 7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Mouse MG50299-M
Angiopoietin-like 7 cDNA ORF Clone, Mouse, untagged MG50299-UT
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50299-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50299-ACG
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50299-ACR
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50299-CF
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50299-NF
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-His tag MG50299-CH
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-His tag MG50299-NH
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-HA tag MG50299-CY
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-HA tag MG50299-NY
Angiopoietin-like 7 cDNA ORF Clone, Mouse, C-Myc tag MG50299-CM
Angiopoietin-like 7 cDNA ORF Clone, Mouse, N-Myc tag MG50299-NM
Angiopoietin-like 7 qPCR Primer Pairs, Mouse MP200322

Angiopoietin-like 7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Angiopoietin-like 7 cDNA ORF Clone in Cloning Vector, Human HG12294-G
Angiopoietin-like 7 cDNA ORF Clone, Human, untagged HG12294-UT
Angiopoietin-like 7 cDNA ORF Clone, Human, C-GFPSpark® tag HG12294-ACG
Angiopoietin-like 7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12294-ACGLN
Angiopoietin-like 7 cDNA ORF Clone, Human, C-OFPSpark® tag HG12294-ACR
Angiopoietin-like 7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12294-CF
Angiopoietin-like 7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12294-NF
Angiopoietin-like 7 cDNA ORF Clone, Human, C-His tag HG12294-CH
Angiopoietin-like 7 cDNA ORF Clone, Human, N-His tag HG12294-NH
Angiopoietin-like 7 cDNA ORF Clone, Human, C-HA tag HG12294-CY
Angiopoietin-like 7 cDNA ORF Clone, Human, N-HA tag HG12294-NY
Angiopoietin-like 7 cDNA ORF Clone, Human, C-Myc tag HG12294-CM
Angiopoietin-like 7 cDNA ORF Clone, Human, N-Myc tag HG12294-NM
Angiopoietin-like 7 qPCR Primer Pairs, Human HP101904
info info
添加购物车成功! 添加购物车失败!