CCL19/MIP-3b cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10232-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CCL19/MIP-3b Reagents

CRO Services


All CCL19/MIP-3b Reagents

CCL19/MIP-3b cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 19 with Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.35kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL19/MIP-3b cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL19/MIP-3b cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

CKb11 cDNA ORF Clone, Human;ELC cDNA ORF Clone, Human;MIP-3b cDNA ORF Clone, Human;MIP3B cDNA ORF Clone, Human;SCYA19 cDNA ORF Clone, Human

CCL19/MIP-3b Background Information

Full Name
chemokine (C-C motif) ligand 19

CCL19/MIP-3b cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CCL19/MIP-3b cDNA ORF Clone in Cloning Vector, Rhesus CG90130-G
CCL19/MIP-3b cDNA ORF Clone, Rhesus, untagged CG90130-UT
CCL19/MIP-3b Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90130-ACGLN
CCL19/MIP-3b cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90130-ACG
CCL19/MIP-3b cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90130-ACR
CCL19/MIP-3b cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90130-CF
CCL19/MIP-3b cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90130-NF
CCL19/MIP-3b cDNA ORF Clone, Rhesus, C-His tag CG90130-CH
CCL19/MIP-3b cDNA ORF Clone, Rhesus, N-His tag CG90130-NH
CCL19/MIP-3b cDNA ORF Clone, Rhesus, C-HA tag CG90130-CY
CCL19/MIP-3b cDNA ORF Clone, Rhesus, N-HA tag CG90130-NY
CCL19/MIP-3b cDNA ORF Clone, Rhesus, C-Myc tag CG90130-CM
CCL19/MIP-3b cDNA ORF Clone, Rhesus, N-Myc tag CG90130-NM

CCL19/MIP-3b cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CCL19/MIP-3b cDNA ORF Clone in Cloning Vector, Mouse MG50047-M
CCL19/MIP-3b cDNA ORF Clone, Mouse, untagged MG50047-UT
CCL19/MIP-3b cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50047-ACG
CCL19/MIP-3b Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50047-ACGLN
CCL19/MIP-3b cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50047-ACR
CCL19/MIP-3b cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50047-CF
CCL19/MIP-3b cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50047-NF
CCL19/MIP-3b cDNA ORF Clone, Mouse, C-His tag MG50047-CH
CCL19/MIP-3b cDNA ORF Clone, Mouse, N-His tag MG50047-NH
CCL19/MIP-3b cDNA ORF Clone, Mouse, C-HA tag MG50047-CY
CCL19/MIP-3b cDNA ORF Clone, Mouse, N-HA tag MG50047-NY
CCL19/MIP-3b cDNA ORF Clone, Mouse, C-Myc tag MG50047-CM
CCL19/MIP-3b cDNA ORF Clone, Mouse, N-Myc tag MG50047-NM
CCL19/MIP-3b qPCR Primer Pairs, Mouse MP200047

CCL19/MIP-3b cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CCL19/MIP-3b cDNA ORF Clone in Cloning Vector, Human HG10232-M
CCL19/MIP-3b cDNA ORF Clone, Human, untagged HG10232-UT
CCL19/MIP-3b cDNA ORF Clone, Human, C-GFPSpark® tag HG10232-ACG
CCL19/MIP-3b Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10232-ACGLN
CCL19/MIP-3b cDNA ORF Clone, Human, C-OFPSpark® tag HG10232-ACR
CCL19/MIP-3b cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10232-CF
CCL19/MIP-3b cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10232-NF
CCL19/MIP-3b cDNA ORF Clone, Human, C-His tag HG10232-CH
CCL19/MIP-3b cDNA ORF Clone, Human, N-His tag HG10232-NH
CCL19/MIP-3b cDNA ORF Clone, Human, C-HA tag HG10232-CY
CCL19/MIP-3b cDNA ORF Clone, Human, N-HA tag HG10232-NY
CCL19/MIP-3b cDNA ORF Clone, Human, C-Myc tag HG10232-CM
CCL19/MIP-3b cDNA ORF Clone, Human, N-Myc tag HG10232-NM
CCL19/MIP-3b qPCR Primer Pairs, Human HP100285
info info
添加购物车成功! 添加购物车失败!